Cat. #157865
HeLa FRT/TO (YFP-Astrin Delta70 siRNA res) cell line
Cat. #: 157865
Sub-type: Continuous
Unit size: 1x10^6 cells / vial
Availability: 10-12 weeks
Organism: Human
Tissue: Cervix
Model: Cancer Model
£575.00
This fee is applicable only for non-profit organisations. If you are a for-profit organisation or a researcher working on commercially-sponsored academic research, you will need to contact our licensing team for a commercial use license.
Contributor
Inventor: Duccio Conti ; Viji M. Draviam
Institute: Queen Mary University of London
Tool Details
*FOR RESEARCH USE ONLY (for other uses, please contact the licensing team)
- Name: HeLa FRT/TO (YFP-Astrin Delta70 siRNA res) cell line
- Alternate name: HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT.
- Research fields: Cancer;Cell biology;Cell signaling and signal transduction
- Tool sub type: Continuous
- Parental cell: HeLa cell line
- Organism: Human
- Tissue: Cervix
- Model: Cancer Model
- Production details: HeLa FRT/TO YFP-Astrin ÄÂ?Â70 cell line conditionally expressing siRNA-resistant YFP-Astrin ÄÂ?Â70. Created by transfection of HeLa Flp recombinase cell line with pCDNA5-FRT/TO-YFP-Astrin ÄÂ?Â70 expression plasmid, followed by a brief Hygromycin selection and sorting for YFP positive using FACS.
- Additional notes: siRNA oligos to target Astrin mRNA 5 UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU). Astrain ?70 mutant was generated by PCR amplification of 11122 coding region of Astrin and subcloning into the desired expression vector.
Applications
- Application notes: siRNA oligos to target Astrin mRNA 5ÄË?Â? UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU). Astrain ÄÂ?Â70 mutant was generated by PCR amplification of 1ÄË?Â?Â1122 coding region of Astrin and subcloning into the desired expression vector.
Handling
- Format: Frozen
- Unit size: 1x10^6 cells / vial
- Shipping conditions: Dry ice
References
- 31808746
