HeLa FRT/TO (YFP-Astrin Delta70 siRNA res) cell line

Contributors

Inventor Institute
Duccio Conti ; Viji M. Draviam Queen Mary University of London
Cat. #: 157865
Tool sub type: Continuous
Unit size: 1×10^6 cells / vial
Research Fields: Cancer;Cell biology;Cell signaling and signal transduction
Organism: Human
Tissue: Cervix
Model: Cancer Model
Alternate name: HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT.
Production details: HeLa FRT/TO YFP-Astrin Î?‚”70 cell line conditionally expressing siRNA-resistant YFP-Astrin Î?‚”70. Created by transfection of HeLa Flp recombinase cell line with pCDNA5-FRT/TO-YFP-Astrin Î?‚”70 expression plasmid, followed by a brief Hygromycin selection and sorting for YFP positive using FACS.
Additional notes: siRNA oligos to target Astrin mRNA 5 UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU). Astrain ?70 mutant was generated by PCR amplification of 11122 coding region of Astrin and subcloning into the desired expression vector.
Parental cell line: HeLa cell line
Format: Frozen
Shipping conditions: Dry ice
References:

31808746

Related Tools for Cell lines

Cat. # Tool Name
151014 MCF7 AREc32 Cell Line Key Info View Tool
151425 TR146 Cell Line Key Info View Tool
151450 JIM3 Cell Line Key Info View Tool
151484 2fTGH Cell Line Key Info View Tool
151448 CMT 167 Cell Line Key Info View Tool

Related News

UM-UC-10 Cell Line. Image courtesy of the European Collection of Authenticated Cell Cultures (ECACC), UK.
Cell Lines

Popular cell lines now available only from CancerTools.org

Read More
Cell Lines

New cell lines: murine melanocyte and melanoblast cell lines from Dr. Elena Sviderskaya

Read More
Image Reference: 2x PTEN -/- mouse prostate cancer cell lines (MuCap system). Histology staining of syngraft tumours (Van Duijn et al., 2018).
Cell Lines

38 new prostate cancer cell lines

Read More

Tool enquiry

Please ensure you use your organisation email address rather than personal where possible, as this helps us locate your organisation in our system faster.

Please note we may take up to three days to respond to your enquiry.

CancerTools.org uses the contact information provided to respond to you about our research tools and service. For more information please review our privacy policy.