Cat. #157864

HeLa FRT/TO (YFP-Astrin 4A siRNA res) cell line

Name: HeLa FRT/TO (YFP-Astrin 4A siRNA res) cell line
SKU: 157864
Availability: InStock

Cat. #: 157864

Sub-type: Continuous

Unit size: 1x10^6 cells / vial

Availability: 10-12 weeks

Organism: Human

Tissue: Cervix

Model: Cancer Model

£575.00

This fee is applicable only for non-profit organisations. If you are a for-profit organisation or a researcher working on commercially-sponsored academic research, you will need to contact our licensing team for a commercial use license.

Enquire or request a quote

Contributor

Inventor: Duccio Conti ; Viji M. Draviam

Institute: Queen Mary University of London

Tool Details

Applications

Handling

References

Tool Details

*FOR RESEARCH USE ONLY (for other uses, please contact the licensing team)

Name: HeLa FRT/TO (YFP-Astrin 4A siRNA res) cell line
Alternate name: HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT.
Research fields: Cancer;Cell biology;Cell signaling and signal transduction
Tool sub type: Continuous
Parental cell: HeLa cell line
Organism: Human
Tissue: Cervix
Model: Cancer Model
Production details: HeLa FRT/TO YFP-Astrin 4A cell line conditionally expressing siRNA-resistant YFP-Astrin 4A. Created by transfection of HeLa Flp recombinase cell line with pCDNA5-FRT/TO-YFP-Astrin 4A expression plasmid, followed by a brief Hygromycin selection and sorting for YFP positive using FACS.
Additional notes: siRNA oligos to target Astrin mRNA 5 UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU). Astrin-4A mutant (RVMF to AAAA substitution) was generated using site directed mutagenesis.

Applications

Application notes: siRNA oligos to target Astrin mRNA 5ÄË?Â?Â UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU). Astrin-4A mutant (RVMF to AAAA substitution) was generated using site directed mutagenesis.

Handling

Format: Frozen
Unit size: 1x10^6 cells / vial
Shipping conditions: Dry ice

References

31808746