CT26 TTPKO cell line

CRISPR/Cas tristetraprolin (TTP) Knock-out KRAS mutant colon carcinoma cell line. In some immunoresistant tumours, PD-L1 expression is upregulated by RAS activation. Via the MEK pathway, the MK2 kinase phosporylates and inhibits TTP, which negatively regulates PD-L1 expression. PD-L1 is a therapeutic target to check the immune evasion mechanism of some cancers.

Contributors

Inventor Institute
Julian Downward The Francis Crick Institute
Cat. #: 157876
Tool sub type: Continuous
Unit size: 1×10^6 cells / vial
Research Fields: Cancer;Cell biology;Cell signaling and signal transduction
Organism: Mouse
Model: Knock-Out
Alternate name: TTP
Product description: CRISPR/Cas tristetraprolin (TTP) Knock-out KRAS mutant colon carcinoma cell line. In some immunoresistant tumours, PD-L1 expression is upregulated by RAS activation. Via the MEK pathway, the MK2 kinase phosporylates and inhibits TTP, which negatively regulates PD-L1 expression. PD-L1 is a therapeutic target to check the immune evasion mechanism of some cancers. CRISPR edited CT26 cells.
Conditional: No
Production details: CRISPR/Cas TTP Knock-out KRAS mutant colon carcinoma cell line.Knock Out of functional TTP was confirmed by Western blot. CompleteZfp36 allele disruption was confirmed by TOPO-TA cloning followed bysequencing.Mouse Zfp36 was targeted with gRNA sequenceGTCATGGCTCATCGACTGGAGG, using U6gRNA-Cas9-2A-GFP
Additional notes: CRISPR edited CT26 cells. Cancer Research Technology Limited (trading research tools as Ximbio) has been granted a non-exclusive license to the CRISPR-Cas9 technology by ERS Genomics Ltd under the patent rights listed here. This license from ERS Genomics Ltd allows Ximbio to develop and commercialise CRISPR-Cas9 modified cell lines for research use only. Ximbio can provi…
Parental cell line: CT26 ATCC-CRL-2638
disease: Cancer
Format: Frozen
Storage conditions: Liquid Nitrogen
Shipping conditions: Dry ice
Growth medium: RPMI-1640 + 10% FCS. Subculture split ratio of 1:4 to 1:10 every 2-3 days.
Recommended controls: CT26 ATCC-CRL-2638 parental cells
Mycoplasma free: Yes
Biosafety level: 1
References:

Coelho et al. 2017. Immunity. 47(6):1083-1099.e6. PMID: 29246442.

Related Tools for Cell lines

Cat. # Tool Name
151448 CMT 167 Cell Line Key Info View Tool
151480 HEK293A EGFP-LC3 Cell Line Key Info View Tool
151488 B6.1.1 Mouse ES Cell Line Key Info View Tool
151503 1-7 CE1 Cell Line Key Info View Tool
151576 MEF RAF1 KO Cell Line Key Info View Tool

Related News

UM-UC-10 Cell Line. Image courtesy of the European Collection of Authenticated Cell Cultures (ECACC), UK.
Cell Lines

Popular cell lines now available only from CancerTools.org

Read More
Cell Lines

New cell lines: murine melanocyte and melanoblast cell lines from Dr. Elena Sviderskaya

Read More
Image Reference: 2x PTEN -/- mouse prostate cancer cell lines (MuCap system). Histology staining of syngraft tumours (Van Duijn et al., 2018).
Cell Lines

38 new prostate cancer cell lines

Read More

Tool enquiry

Please ensure you use your organisation email address rather than personal where possible, as this helps us locate your organisation in our system faster.

Please note we may take up to three days to respond to your enquiry.

CancerTools.org uses the contact information provided to respond to you about our research tools and service. For more information please review our privacy policy.