Cat. #157876
CT26 TTPKO cell line
Cat. #: 157876
Sub-type: Continuous
Unit size: 1x10^6 cells / vial
Availability: 3-4 weeks
Organism: Mouse
Disease: Cancer
Model: Knock-Out
£575.00
This fee is applicable only for non-profit organisations. If you are a for-profit organisation or a researcher working on commercially-sponsored academic research, you will need to contact our licensing team for a commercial use license.
Contributor
Inventor: Julian Downward
Institute: The Francis Crick Institute
Tool Details
*FOR RESEARCH USE ONLY (for other uses, please contact the licensing team)
- Name: CT26 TTPKO cell line
- Alternate name: TTP
- Research fields: Cancer;Cell biology;Cell signaling and signal transduction
- Tool sub type: Continuous
- Parental cell: CT26 ATCC-CRL-2638
- Organism: Mouse
- Disease: Cancer
- Model: Knock-Out
- Conditional: No
- Description: CRISPR/Cas tristetraprolin (TTP) Knock-out KRAS mutant colon carcinoma cell line. In some immunoresistant tumours, PD-L1 expression is upregulated by RAS activation. Via the MEK pathway, the MK2 kinase phosporylates and inhibits TTP, which negatively regulates PD-L1 expression. PD-L1 is a therapeutic target to check the immune evasion mechanism of some cancers. CRISPR edited CT26 cells.
- Production details: CRISPR/Cas TTP Knock-out KRAS mutant colon carcinoma cell line.Knock Out of functional TTP was confirmed by Western blot. CompleteZfp36 allele disruption was confirmed by TOPO-TA cloning followed bysequencing.Mouse Zfp36 was targeted with gRNA sequenceGTCATGGCTCATCGACTGGAGG, using U6gRNA-Cas9-2A-GFP
- Biosafety level: 1
- Additional notes: CRISPR edited CT26 cells. Cancer Research Technology Limited (trading research tools as Ximbio) has been granted a non-exclusive license to the CRISPR-Cas9 technology by ERS Genomics Ltd under the patent rights listed here. This license from ERS Genomics Ltd allows Ximbio to develop and commercialise CRISPR-Cas9 modified cell lines for research use only. Ximbio can provi...
- Recommended controls: CT26 ATCC-CRL-2638 parental cells
Target Details
- Target: Tristetraprolin (TTP)
Applications
- Application notes: Cancer Research Technology Limited (trading research tools as CancerTools.org) has been granted a non-exclusive license to the CRISPR-Cas9 technology by ERS Genomics Ltd under the patent rights listed here: https://www.cancertools.org/tool-faqs#hs_cos_wrapper_widget_1649861453796 This license from ERS Genomics Ltd allows CancerTools.org to develop and commercialise CRISPR-Cas9 modified cell lines for research use only. CancerTools.org can provide these modified CRISPR-Cas9 cell lines to comp...
Handling
- Format: Frozen
- Growth medium: RPMI-1640 + 10% FCS. Subculture split ratio of 1:4 to 1:10 every 2-3 days.
- Unit size: 1x10^6 cells / vial
- Shipping conditions: Dry ice
- Storage conditions: Liquid Nitrogen
- Mycoplasma free: Yes
References
- Coelho et al. 2017. Immunity. 47(6):1083-1099.e6. PMID: 29246442.