Cat. #157863
HeLa FRT/TO (YFP-Astrin WT siRNA res) cell line
Cat. #: 157863
Sub-type: Continuous
Unit size: 1x10^6 cells / vial
Organism: Human
Tissue: Cervix
Model: Cancer Model
£575.00
This fee is applicable only for non-profit organisations. If you are a for-profit organisation or a researcher working on commercially-sponsored academic research, you will need to contact our licensing team for a commercial use license.
Contributor
Inventor: Duccio Conti ; Viji M. Draviam
Institute: Queen Mary University of London
Tool Details
*FOR RESEARCH USE ONLY
- Name: HeLa FRT/TO (YFP-Astrin WT siRNA res) cell line
- Alternate name: HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT.
- Tool sub type: Continuous
- Parental cell: HeLa cell line
- Organism: Human
- Tissue: Cervix
- Model: Cancer Model
- Production details: HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT. Created by transfection of HeLa Flp recombinase cell line with pCDNA5-FRT/TO-YFP-Astrin WT expression plasmid, followed by a brief Hygromycin selection and sorting for YFP positive using FACS.
- Additional notes: siRNA oligos to target Astrin mRNA 5 UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU).
Applications
- Application notes: siRNA oligos to target Astrin mRNA 5ÄË?Â? UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU).
Handling
- Format: Frozen
- Unit size: 1x10^6 cells / vial
- Shipping conditions: Dry ice
References
- 31808746