3LL NRAS KO #86 cell line

A genetically engineered murine lung cancer model used to study KRAS G12C dependency, targeted inhibitor response, and combination therapuetic strategies. Save 30% on this cell line this autumn. Use code ACA26CELL at checkout.

Contributors

Inventor Institute
Julian Downward The Francis Crick Institute
SKU: 157772
Product description: Murine Lewis lung adenocarcinoma engineered cells represent a model for study of the effect of KRAS-G12C inhibitors on oncogenic cells. The cell line was established from 3LL cells by NRAS knocking out using CRISPR-Cas9 to promote a stronger dependency on oncogenic G12C KRAS. It was used in development of combination therapies to maximize the impact of G12C KRAS inhibitors in lung cancer.
Alternate name: 3LL ΔNRAS
CRISPR: Yes
Conditional: No
Production details: NRAS CRISPR/Cas knockout: To knock out NRAS, 3LL cells were transiently transfected with the pSpCas9(BB)-2A-GFP vector (PX458, Addgene) expressing a GFP expression cassette and with the gRNA 5’-gRNA-‘3 ACTGGACACAGCTGGACATG, PAM: ATG. GFP-positive cells were sorted using a MoFlo XDP sorter and single cell cloned manually. Clones were amplified and NRAS protein was quantified by Western blot
Additional notes: CRISPR edited 3LL cells.Cancer Research Technology Limited (trading research tools as Ximbio) has been granted a non-exclusive license to the CRISPR-Cas9 technology by ERS Genomics Ltd under the patent rights listed here.This license from ERS Genomics Ltd allows Ximbio to develop and commercialise CRISPR-Cas9 modified cell lines for research use only. Ximbio can provide these modified CRISPR-Cas9 cell lines to companies under a label…
Parental cell line: 3LL aka LL/2 (LLC1) likely origin – the authors have established (by DNA sequencing) that these cells are homozygous for the KRAS-G12C & NRAS-Q61H mutations which is not the case for the parent 3LL ATCC line
Model description: NRAS KO using CRISPR/Cas9 to promote a stronger dependency on oncogenic G12C KRAS
Disease: Cancer
Cat. #: 157772
Tool sub type: Continuous
Unit size: 1×10^6 cells / vial
Cancer types: Lung cancer
Organism: Mouse
Tissue: Lung
Model: Knock-Out
Growth properties: Semi-adherent
Cancer Types In Detail: Lung Adenocarcinoma
Primary citation: Molina-Arcas et al. 2019. Sci Transl Med. 11(510). PMID: 31534020
Format: Frozen
Storage conditions: Liquid Nitrogen
Shipping conditions: Dry ice
Growth medium: RPMI + 10% FCS + 1% Penicillin/Streptomycin
Mycoplasma free: Yes
Biosafety level: 1
References:

Molina-Arcas et al. 2019. Sci Transl Med. 11(510). PMID: 31534020

Images

View Gallery

Citations And Reviews

Related Tools for Cell lines

Cat. # Tool Name
157771 3LL NRAS KO #63 cell line Key Info View Tool

Tool enquiry

Please ensure you use your organisation email address rather than personal where possible, as this helps us locate your organisation in our system faster.

Please note we may take up to three days to respond to your enquiry.

CancerTools.org uses the contact information provided to respond to you about our research tools and service. For more information please review our privacy policy.