3LL NRAS KO #63 cell line
Model cell line for study of the effect of KRAS-G12C inhibitors on oncogenic cells.
Contributors
| Inventor | Institute |
|---|---|
| Julian Downward | The Francis Crick Institute |
| SKU: | 157771 |
|---|---|
| Product description: | Murine Lewis lung adenocarcinoma engineered cells represent a model for study of the effect of KRAS-G12C inhibitors on oncogenic cells. The cell line was established from 3LL cells by NRAS knocking out using CRISPR-Cas9 to promote a stronger dependency on oncogenic G12C KRAS. It was used in development of combination therapies to maximize the impact of G12C KRAS inhibitors in lung cancer |
| Alternate name: | 3LL ΔNRAS |
| Gender: | Male |
| CRISPR: | Yes |
| Conditional: | No |
| Production details: | NRAS CRISPR/Cas knockout: To knock out NRAS, 3LL cells were transiently transfected with the pSpCas9(BB)-2A-GFP vector (PX458, Addgene) expressing a GFP expression cassette and with the gRNA 5’-gRNA-‘3 ACTGGACACAGCTGGACATG, PAM: ATG. GFP-positive cells were sorted using a MoFlo XDP sorter and single cell cloned manually. Clones were amplified and NRAS protein was quantified by Western blot |
| Additional notes: | CRISPR edited 3LL cells.Cancer Research Technology Limited (trading research tools as Ximbio) has been granted a non-exclusive license to the CRISPR-Cas9 technology by ERS Genomics Ltd under the patent rights listed here.This license from ERS Genomics Ltd allows Ximbio to develop and commercialise CRISPR-Cas9 modified cell lines for research use only. Ximbio can provide these modified CRISPR-Cas9 cell lines to companies under a label… |
| Parental cell line: | 3LL aka LL/2 (LLC1) likely origin – the authors have established (by DNA sequencing) that these cells are homozygous for the KRAS-G12C & NRAS-Q61H mutations which is not the case for the parent 3LL ATCC line |
| Model description: | NRAS KO using CRISPR/Cas9 to promote a stronger dependency on oncogenic G12C KRAS |
| Disease: | Cancer |
| Cat. #: | 157771 |
|---|---|
| Tool sub type: | Continuous |
| Unit size: | 1×10^6 cells / vial |
| Cancer types: | Lung cancer |
| Organism: | Mouse |
| Tissue: | Lung |
| Gender: | Male |
| Model: | Knock-Out |
| Growth properties: | Semi-adherent |
| Primary citation: | Molina-Arcas et al. 2019. Sci Transl Med. 11(510). PMID: 31534020 |
| Format: | Frozen |
|---|---|
| Storage conditions: | Liquid Nitrogen |
| Shipping conditions: | Dry ice |
| Growth medium: | RPMI + 10% FCS + 1% Penicillin/Streptomycin |
| Mycoplasma free: | Yes |
| Biosafety level: | 1 |
| References: |
Molina-Arcas et al. 2019. Sci Transl Med. 11(510). PMID: 31534020 |
|---|
Images
View Gallery
Product Images
Related Tools for Cell lines
| Cat. # | Tool Name | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 157772 | 3LL NRAS KO #86 cell line |
Key Info
3LL NRAS KO #86 cell line
|
View Tool | |||||||||||
