CRISPR/Cas tristetraprolin (TTP) Knock-out KRAS mutant colon carcinoma cell line. In some immunoresistant tumours, PD-L1 expression is upregulated by RAS activation. Via the MEK pathway, the MK2 kinase phosporylates and inhibits TTP, which negatively regulates PD-L1 expression. PD-L1 is a therapeutic target to check the immune evasion mechanism of some cancers.
| Inventor | Institute |
|---|---|
| Julian Downward | The Francis Crick Institute |
| SKU: | 157876 |
|---|---|
| Product description: | CRISPR/Cas tristetraprolin (TTP) Knock-out KRAS mutant colon carcinoma cell line. In some immunoresistant tumours, PD-L1 expression is upregulated by RAS activation. Via the MEK pathway, the MK2 kinase phosporylates and inhibits TTP, which negatively regulates PD-L1 expression. PD-L1 is a therapeutic target to check the immune evasion mechanism of some cancers. CRISPR edited CT26 cells. |
| Alternate name: | TTP |
| Conditional: | No |
| Production details: | CRISPR/Cas TTP Knock-out KRAS mutant colon carcinoma cell line.Knock Out of functional TTP was confirmed by Western blot. CompleteZfp36 allele disruption was confirmed by TOPO-TA cloning followed bysequencing.Mouse Zfp36 was targeted with gRNA sequenceGTCATGGCTCATCGACTGGAGG, using U6gRNA-Cas9-2A-GFP |
| Additional notes: | CRISPR edited CT26 cells. Cancer Research Technology Limited (trading research tools as Ximbio) has been granted a non-exclusive license to the CRISPR-Cas9 technology by ERS Genomics Ltd under the patent rights listed here. This license from ERS Genomics Ltd allows Ximbio to develop and commercialise CRISPR-Cas9 modified cell lines for research use only. Ximbio can provi… |
| Parental cell line: | CT26 ATCC-CRL-2638 |
| Disease: | Cancer |
| Cat. #: | 157876 |
|---|---|
| Tool sub type: | Continuous |
| Unit size: | 1×10^6 cells / vial |
| Cancer types: | Colorectal cancer |
| Research Fields: | Cancer; Cell biology; Cell signaling and signal transduction |
| Organism: | Mouse |
| Model: | Knock-Out |
| Format: | Frozen |
|---|---|
| Storage conditions: | Liquid Nitrogen |
| Shipping conditions: | Dry ice |
| Growth medium: | RPMI-1640 + 10% FCS. Subculture split ratio of 1:4 to 1:10 every 2-3 days. |
| Recommended controls: | CT26 ATCC-CRL-2638 parental cells |
| Mycoplasma free: | Yes |
| Biosafety level: | 1 |
| References: |
Coelho et al. 2017. Immunity. 47(6):1083-1099.e6. PMID: 29246442. |
|---|
Please note we may take up to three days to respond to your enquiry.
CancerTools.org uses the contact information provided to respond to you about our research tools and service. For more information please review our privacy policy.