HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT.
Production details:
HeLa FRT/TO YFP-Astrin 4A cell line conditionally expressing siRNA-resistant YFP-Astrin 4A. Created by transfection of HeLa Flp recombinase cell line with pCDNA5-FRT/TO-YFP-Astrin 4A expression plasmid, followed by a brief Hygromycin selection and sorting for YFP positive using FACS.
Additional notes:
siRNA oligos to target Astrin mRNA 5 UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU). Astrin-4A mutant (RVMF to AAAA substitution) was generated using site directed mutagenesis.
Parental cell line:
HeLa cell line
Cat. #:
157864
Tool sub type:
Continuous
Unit size:
1×10^6 cells / vial
Research Fields:
Cancer; Cell biology; Cell signaling and signal transduction
Please ensure you use your organisation email address rather than personal where possible, as this helps us locate your organisation in our system faster.
Please note we may take up to three days to respond to your enquiry.
CancerTools.org uses the contact information provided to respond to you about our research tools and service. For more information please review our privacy policy.